Review



gfp shrna cassette  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc gfp shrna cassette
    Gfp Shrna Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 170 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/pm39786847-293-49-55?v=Addgene+inc
    Average 95 stars, based on 170 article reviews
    gfp shrna cassette - by Bioz Stars, 2026-07
    95/100 stars

    Images



    Similar Products

    gfp shrna cassette  (Addgene inc)
    95
    Addgene inc gfp shrna cassette
    Gfp Shrna Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/pm39786847-293-49-55?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    gfp shrna cassette - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    mir30 cassette  (Addgene inc)
    92
    Addgene inc mir30 cassette
    Mir30 Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/us11951184-136-59-64?v=Addgene+inc
    Average 92 stars, based on 1 article reviews
    mir30 cassette - by Bioz Stars, 2026-07
    92/100 stars
    		  Buy from Supplier
    gfp-lentiviral plasmid containing a non-effective 29-mer scrambled shrna cassette  (OriGene)
    90
    OriGene gfp-lentiviral plasmid containing a non-effective 29-mer scrambled shrna cassette
    Gfp Lentiviral Plasmid Containing A Non Effective 29 Mer Scrambled Shrna Cassette, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/pm35953814-135-13-25?v=OriGene
    Average 90 stars, based on 1 article reviews
    gfp-lentiviral plasmid containing a non-effective 29-mer scrambled shrna cassette - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    plasmid dna cocktail encoding anti-p53 shrna carrying a gfp expression cassette  (Addgene inc)
    90
    Addgene inc plasmid dna cocktail encoding anti-p53 shrna carrying a gfp expression cassette
    Plasmid Dna Cocktail Encoding Anti P53 Shrna Carrying A Gfp Expression Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/pmc08357237-232-26-60?v=Addgene+inc
    Average 90 stars, based on 1 article reviews
    plasmid dna cocktail encoding anti-p53 shrna carrying a gfp expression cassette - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    plko 1 sh β catenin 1248 ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 gfp shrna cassette  (Addgene inc)
    95
    Addgene inc plko 1 sh β catenin 1248 ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 gfp shrna cassette
    Plko 1 Sh β Catenin 1248 Ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 Gfp Shrna Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/pmc08027267-311-27-37?v=Addgene+inc
    Average 95 stars, based on 1 article reviews
    plko 1 sh β catenin 1248 ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 gfp shrna cassette - by Bioz Stars, 2026-07
    95/100 stars
    		  Buy from Supplier
    pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)  (Shanghai GenePharma)
    90
    Shanghai GenePharma pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)
    Pgphi/Gfp/Neo Plasmid Containing Vegf Shrna Expression Cassette (Target 9 Sequence: Ggagtaccctgatgagatcga), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/pm31846730-75-0-32?v=Shanghai+GenePharma
    Average 90 stars, based on 1 article reviews
    pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga) - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    lentiviral plasmids bag3 shrna and luc shrna target sequences and a gfp expression cassette  (Genechem)
    90
    Genechem lentiviral plasmids bag3 shrna and luc shrna target sequences and a gfp expression cassette
    Lentiviral Plasmids Bag3 Shrna And Luc Shrna Target Sequences And A Gfp Expression Cassette, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/pmc04731677-81-0-18?v=Genechem
    Average 90 stars, based on 1 article reviews
    lentiviral plasmids bag3 shrna and luc shrna target sequences and a gfp expression cassette - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier
    lentiviral plasmids containing bag3 shrna and luc shrna target sequences and a gfp expression cassette  (Genechem)
    90
    Genechem lentiviral plasmids containing bag3 shrna and luc shrna target sequences and a gfp expression cassette
    Lentiviral Plasmids Containing Bag3 Shrna And Luc Shrna Target Sequences And A Gfp Expression Cassette, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/gfp+shrna+cassette/pmc04731677-58-10-25?v=Genechem
    Average 90 stars, based on 1 article reviews
    lentiviral plasmids containing bag3 shrna and luc shrna target sequences and a gfp expression cassette - by Bioz Stars, 2026-07
    90/100 stars
    		  Buy from Supplier

    Image Search Results