Review



gfp shrna cassette  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 95
      Buy from Supplier

    Structured Review

    Addgene inc gfp shrna cassette
    Gfp Shrna Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 169 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp shrna cassette/product/Addgene inc
    Average 95 stars, based on 169 article reviews
    gfp shrna cassette - by Bioz Stars, 2026-02
    95/100 stars

    Images



    Similar Products

    gfp shrna cassette  (Addgene inc)
    95
    Addgene inc gfp shrna cassette
    Gfp Shrna Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp shrna cassette/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    gfp shrna cassette - by Bioz Stars, 2026-02
    95/100 stars
    		  Buy from Supplier
    mir30 cassette  (Addgene inc)
    92
    Addgene inc mir30 cassette
    Mir30 Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/mir30 cassette/product/Addgene inc
    Average 92 stars, based on 1 article reviews
    mir30 cassette - by Bioz Stars, 2026-02
    92/100 stars
    		  Buy from Supplier
    scramble shrna cassette in plenti-gfp  (OriGene)
    90
    OriGene scramble shrna cassette in plenti-gfp
    Scramble Shrna Cassette In Plenti Gfp, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scramble shrna cassette in plenti-gfp/product/OriGene
    Average 90 stars, based on 1 article reviews
    scramble shrna cassette in plenti-gfp - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    gfp-lentiviral plasmid containing a non-effective 29-mer scrambled shrna cassette  (OriGene)
    90
    OriGene gfp-lentiviral plasmid containing a non-effective 29-mer scrambled shrna cassette
    Gfp Lentiviral Plasmid Containing A Non Effective 29 Mer Scrambled Shrna Cassette, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gfp-lentiviral plasmid containing a non-effective 29-mer scrambled shrna cassette/product/OriGene
    Average 90 stars, based on 1 article reviews
    gfp-lentiviral plasmid containing a non-effective 29-mer scrambled shrna cassette - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    plasmid dna cocktail encoding anti-p53 shrna carrying a gfp expression cassette  (Addgene inc)
    90
    Addgene inc plasmid dna cocktail encoding anti-p53 shrna carrying a gfp expression cassette
    Plasmid Dna Cocktail Encoding Anti P53 Shrna Carrying A Gfp Expression Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plasmid dna cocktail encoding anti-p53 shrna carrying a gfp expression cassette/product/Addgene inc
    Average 90 stars, based on 1 article reviews
    plasmid dna cocktail encoding anti-p53 shrna carrying a gfp expression cassette - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    plko 1 sh β catenin 1248 ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 gfp shrna cassette  (Addgene inc)
    95
    Addgene inc plko 1 sh β catenin 1248 ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 gfp shrna cassette
    Plko 1 Sh β Catenin 1248 Ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 Gfp Shrna Cassette, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/plko 1 sh β catenin 1248 ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 gfp shrna cassette/product/Addgene inc
    Average 95 stars, based on 1 article reviews
    plko 1 sh β catenin 1248 ccggaggtgctatctgtctgctctactcgagtagagcagacagatagcacctttttt 19761 gfp shrna cassette - by Bioz Stars, 2026-02
    95/100 stars
    		  Buy from Supplier
    pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)  (Shanghai GenePharma)
    90
    Shanghai GenePharma pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)
    Pgphi/Gfp/Neo Plasmid Containing Vegf Shrna Expression Cassette (Target 9 Sequence: Ggagtaccctgatgagatcga), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)/product/Shanghai GenePharma
    Average 90 stars, based on 1 article reviews
    pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga) - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier
    lentiviral vectors expressing shrna for mouse β3-int, gfp protein and the selection cassette tl50112  (OriGene)
    90
    OriGene lentiviral vectors expressing shrna for mouse β3-int, gfp protein and the selection cassette tl50112
    Lentiviral Vectors Expressing Shrna For Mouse β3 Int, Gfp Protein And The Selection Cassette Tl50112, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/lentiviral vectors expressing shrna for mouse β3-int, gfp protein and the selection cassette tl50112/product/OriGene
    Average 90 stars, based on 1 article reviews
    lentiviral vectors expressing shrna for mouse β3-int, gfp protein and the selection cassette tl50112 - by Bioz Stars, 2026-02
    90/100 stars
    		  Buy from Supplier

    Image Search Results